Abstract
The present study aims to diagnose diarrheagenic E. coli in meat and meat products by the conventional polymerase chain reaction (PCR) technique using the uidA gene to confirm the existence of the bacterial isolates as E. coli. The multiplex PCR technique is adopted to detect the virulence genes of these bacteria using two groups of primers for detecting the gene (stx1, stx2, aggR, esth, eae, invE, daaC, estp, elt, and bfpA). This study applies these primers to 100 E. coli strains isolated from 782 samples of meat and meat products (fresh, minced, burger, pastirma, and chicken) from February to November 2020. The results of the present study show that all E. coli isolates are positive to have the uidA gene (147 bp). The study also detects 95/782 (12.15%) pathogenic species related to virulence genes by using multiplex PCR. The highest percentage of pathotype is ETEC, 46.32%, and the lowest is the DAEC type 1.05%. In addition, the other pathotypes are 20.05, 14.74, 6.32, 6.32, and 5.26% of STEC, EHEC, aEPEC, EAEC, and EIEC, respectively. The high contamination rate with DEC reported in this study is associated with the poor hygiene conditions of slaughtering and meat storage in shops and markets, resulting in health risks to consumers.
Keywords
Main Subjects
Highlights
Full Text
Introduction
Escherichia coli is one of the most important types of the Enterobacteriaceae family that is naturally endemic to the alimentary canal of humans and animals (1). The opportunistic bacteria of E. coli can infect a body whenever an opportunity exists, causing many diseases such as diarrhea, meningitis, septicemia, and bacteremia (2,3). Meat and meat products are important food items for humans because they are rich in animal proteins, fats, minerals, and vitamins. Recently, the increasing meat consumption may be a source of the danger threatening human health. Meat is a suitable environment for the growth of many different types of pathogenic and non-pathogenic germs that are transmitted from meat to humans such as E. coli which can generate a large and diverse group of diarrheal bacteria called Diarrheagenic E. coli (DEC) (4-6). The pathogenicity of E. coli is closely related to many types of virulence factors and their pathological features. The pathological types are classified into six groups: Enteropathogenic E. coli (EPEC), Enterotoxigenic E. coli (ETEC), Enterohemorrhagic E. coli. or Shiga-toxigenic E. coli (STEC), Enteroaggregative E. coli (EAEC), Enteroinvasive E. coli (EIEC), and diffusely adhering Escherichia coli (DAEC) (7). It is not possible to use cultures or biochemical tests for distinguishing the symbiotic and pathological strains of these bacteria in a laboratory because of the large number of pathological types and virulence factors. Therefore, the polymerase chain reaction (PCR) is one of the most important techniques to detect virulence genes (8). Additionally, the multiplex Polymerase Chain Reaction (mPCR) technique is used to detect the presence or absence of several genes encoding major virulence factors for the diagnosis of DEC isolated bacteria, particularly when dealing with large samples (9).
The current study aims to identify E. coli in meat and meat products using conventional molecular methods, detect the species-specific uidA gene of E. coli, and identify the different types of genes that encode the virulence factors of E. coli by using the mPCR technique.
Materials and methods
Sampling
A total of 100 E. coli strains were isolated previously from 782 samples of meat and meat products including fresh meat (beef, sheep, buffalo, and goats), minced meat, burgers (local and imported), pastirma, and chicken meat (local and imported) collected from different butchers’ shops and restaurants at Mosul city from 2/3/2020 to 5/11/2020. The samples were transmitted directly to the laboratory of Microbiology, Department of Biology, College of Education for Pure Sciences, and College of Veterinary Medicine, University of Mosul, Iraq for preparation, isolation, and molecular detection of E. coli bacteria (10).
DNA extraction and amplification
The pure E. coli colonies were selected and added to 200 μl of sterile distilled water in a 1.5 ml Eppendorf tube. After that, they were mixed with a vortex mixer device. The cells were lysed for at least 15 seconds and the DNA was extracted using the laboratory kit prepared by (Jena) Bioscience (11).
The species-specific conventional polymerase chain reaction (PCR) technique was used to confirm the E. coli isolates with the application of the universal primers of uidA (Table 1). The master mix was prepared for all the PCR using the Gen Net Bio kit by calculating the required volumes of reaction components for each sample. The additives were mixed well and distributed in a volume of 18 μl into small PCR tubes in a 0.2ml volume for the PCR procedure. After that, the extracted DNA from the samples in a 2 μl volume was added separately to the tube of each sample and the total volume in each tube was 20 μl. All PCR tubes were placed in the T100TM thermocycler (Bio-Rad, USA) and the PCR program was used at 94 °C for 10 min as an initial denaturation. 35 cycles (94° C for 45 sec, 58 °C for 45 sec, and 72 °C for 1 min) were applied. The final elongation was 72 °C for 10 min. The tubes were removed from the apparatus and placed in the refrigerator at 4-8°C until the electrophoresis was performed to detect the products of the DNA amplification process. For further analysis of DEC using the PCR technique according to Fujioka & Coworkers (12), two groups of primer mixtures were prepared for the DEC classification in meat samples (Table 1).
Table 1: The Sequences of the Primers used in the study
Genes |
Path type |
Primer Sequence (5' to 3') |
Size (bp) |
Primer Conc. (pmol/μl) |
Reference |
uidA |
E. coli |
AAAACGGCAAGAAAAAGCAG ACGCGTGGTTACAGTCTTGCG |
147 |
10 |
(13) |
Stx1 |
STEC. EHEC |
AGTTAATGTGGTGGCGAAGG CACCAGACAATGTAACCGC |
347 |
5 |
(12) |
Stx2 |
STEC. EHEC |
TTCGGTATCCTATTCCCGG CGTCATCGTATACACAGGAG |
592 |
4 |
(12) |
Eae |
EHEC.tEPEC.aEpEC |
CCCGAATTCGGCACAAGCATAAGC CCCGGATCCGTCTCGCCAGTATTCG |
881 |
5 |
(14) |
bfpA |
tEPEC |
AATGGTGCTTGCGCTTGCTGC GCCGCTTTATCCAACCTGGTA |
324 |
5 |
(15) |
aggR |
EAEC |
GTATACACAAAAGAAGGAAGC ACAGAATCGTCAGCATCAGC |
254 |
4 |
(14) |
Elt |
ETEC |
AACGTTCCGGAGGTCTTATG CAACCTTGTGGTGCATGATG |
511 |
3 |
(12) |
Esth |
ETEC |
TTCACCTTTCCCTCAGGATG ATAGCACCCGGTACAAGCAG |
172 |
4 |
(12) |
Estp |
ETEC |
ACTGAATCACTTGACTCTTCA TCACAGCAGTAAAATGTGTTCT |
120 |
10 |
(12) |
invE |
EIEC |
GCAGGAGCATCTTGAAG GAAAGGCACGAGTGACTTTC |
208 |
10 |
(12) |
daaC |
DAEC |
CACTGTGGGCTCCGCGCAAGC CGGTGAGGTTCACTGTGTAT |
418 |
10 |
(16) |
uidA: the gene encoding the enzyme B-glucuronidase, Stx: Shiga-like toxins, eae: Intimin, bfpA: bundle-forming filaments, aggR: virulence genes that stimulate transcription in EAEC, elt: heat-labile toxins, esth and estp protein: heat-stable toxin, invE: invasive toxins, daaC: From the adhesion family.
The mixture groups were organized in such a way that each group had the closest initial annealing temperature and the farthest PCR product volumes. The first group was added to the reaction mixture to detect the genes (stx1, stx2, aggR, esth, and eae). The second set of primers was used to detect the invE, daaC, estp, elt, and bfpA genes for both sets of primers. The total volume of the PCR reaction mixture was 50 μl consisting of 25 μl of Hot Start Premix and 5 μl of primer mixture for each similar gene. 4 μl of DNA (100 ng/µL) of the sample and nuclease-free water were added up to 50 µL. The PCR preparation program was adjusted to preheat for 5 minutes at 95°C, followed by a 35 cycle with 1 minute at 94°C, 1 minute at 55°C, and 1 minute at 72°C, post-reaction, and sequential polymerization for 10 minutes at 72°C. The PCR products were migrated by the electrophoresis at 85 V for 40 minutes in a 2% agarose gel prepared from Tris-acetate-EDTA (TAE x1) solution, then stained by the Ethidium bromide to be photographed with a digital camera.
Statistical analysis
The differences in the distribution rates of DEC pathotypes among the different meat samples were calculated by the Chi-square test by using the SPSS statistical program at P<0.05.
Results
As far as the molecular assays and polymerase chain reaction are concerned, the DNA was extracted from the E. coli isolates from the different types of samples. The concentration of DNA extracted from the bacterial isolates ranged from 265 to 345 ng/μl and the DNA purity ranged from1.75 from 1.98. Figure 1 shows the genome packages of DNA extracted from the bacterial isolates of E. coli on the agarose gel. The results of the present study show that all positive E. coli isolates possessed the uidA gene and bands with a molecular weight of 147 bp (Figure 2). The mPCR technique was adopted to investigate the presence or absence of the virulence genes encoding important virulence factors of E. coli using the species-specific primers that target each virulence gene and to ensure the relevance of the isolates to these bacteria (DEC). The results of these primers show a difference in the number of amplification bands and their molecular weights according to the adopted primer (Figures 3).
Figure 1: Agarose gel electrophoresis of DNA extracted from E. coli isolates. Lane M: Ladder. DNA 100 bp and Lane 1-13 represents extracted DNA.
Figure 2: Agarose gel electrophoresis of PCR products for the detection of the uidA gene in E. coli isolates. Lane M: Ladder DNA 100 bp, Lane 1-11 represents samples of 147 base pairs, Lane 12 represents the negative control.
Figure 3: A: Agarose gel electrophoresis of PCR products for the detection of virulence genes. Lane M: Ladder DNA 100 bp, and Lane 1 represents a positive sample of genes are = 881 bp, stx2 = 592 bp, and stx1 = 347 bp., Lane 6 represents the negative control. B: PCR products for the detection of virulence genes in E. coli isolates. Lane 3 represents a positive sample for estp = 120 bp, invE = 208 bp, and STX1 = 347 bp. Lane 16 represents the negative control.
The current study detects pathogenic species related to virulence genes in 95 (12.15%) samples (Table 2). The study shows that the highest percentage of these pathotypes are in minced meat from restaurants and butcher shops, 40% and 46.7%, respectively. In addition, meat products show a significant difference at 0.05 from all other types of meat and meat products. No significant difference between burger products and beef products is reported, whereas a significant difference between these products and the rest types in the study is noted. The results also show that there are no significant differences between other types of meat such as sheep, buffalo, goat, pastirma products, and the two types of local and imported chicken meat. The percentage of diarrheagenic E. coli (DEC) is shared by the rest of meat and meat products. Pastirma and imported chicken meat show the lowest percentage 6%.
Figure 2 shows that the highest percentage of pathotype 46.32% is ETEC and that the lowest percentage of pathotype 1.05% in this study is due to DAEC. On the other hand, the percentages of the other pathotypes are 20.05, 14.74, 6.32, 6.32, and 5.26% for STEC, EHEC, aEPEC, EAEC, and EIEC respectively. The study shows that there is a significant difference between the ETEC pathotype and all the other pathotypes. In addition, the STEC pathotype shows a significant difference from the other pathotypes, noting that EAEC, EIEC, DAEC, and aEPEC pathotypes do not have any significant difference between them. Table 2 shows that there are significant differences between the types of meat and the meat products within the same pathotypes that cause diarrhea. On the contrary, there is no significant difference between meat and meat products within the same pathotype in some types, as in the case of EAEC and AIEC pathotypes. As for the EHEC type which is considered important in food poisoning, the percentages are very low 14.74% in the fresh meat of cows, sheep, buffaloes, goats, minced meat of both types, and local and imported burgers. This pathological type is not detected in pastirma and chicken in this study.
Table 2: Distribution of Diarrheagenic E. coli (DEC) pathotypes in the studied samples of meat and meat products
Type |
n sample |
Total n (%) |
n (%) of diarrheagenic Escherichia coli pathotypes |
||||||
EHEC |
ETEC |
STEC |
EAEC |
EIEC |
DAEC |
a EPEC |
|||
Beef |
128 |
18(14.06) bc |
3(16.7) bc |
7(38.9) c |
5(27.8) ab |
2(11.11) a |
- |
- |
1(5.55) b |
Sheep meat |
128 |
8(6.25) c |
2(25) ab |
4(50) bc |
1(12.5) c |
- |
- |
(12.5)1 |
- |
Buffalo meat |
128 |
11(8.59) c |
1(9.09) c |
5(45.5) c |
2(18.18) bc |
1(9.09) a |
1(9.09) a |
- |
1(9.09) b |
Goat meat |
128 |
10(7.81) c |
2(20) ab |
4(40) c |
2(20) bc |
1(10) a |
1(10) a |
- |
- |
Ground meat (shops) |
30 |
14(46.7) a |
1(7.14) c |
7(50) bc |
2(14.29) c |
1(7.14) a |
2(14.29) a |
- |
1(7.14) b |
Ground meat (restaurants) |
30 |
12(40) a |
2(16.67) bc |
5(41.79) c |
3(25) ab |
1(8.33) a |
- |
- |
1(8.33) b |
Imported beef Burger |
30 |
5(16.7) bc |
1(20) ab |
3(60) ab |
1(20) bc |
- |
- |
- |
- |
Local beef burger |
30 |
7(23.33) b |
2(28.57) a |
3(42.9) c |
1(14.29) c |
- |
1(14.29) a |
- |
- |
Pastirma |
50 |
3(6) c |
- |
2(66.67) a |
1(33.33) a |
- |
- |
- |
- |
Imported chicken |
50 |
3(6) c |
- |
2(66.67) a |
- |
- |
- |
- |
1(33.33) a |
Local chicken |
50 |
4(8) c |
- |
2(50) bc |
1(25) ab |
- |
- |
- |
1(25) a |
Total number |
782 |
95(12.15) c |
14(14.74) cd |
44(46.32) a |
19(20.05) bc |
6(6.32) de |
5(5.26) e |
1(1.05) e |
6(6.32) de |
Figure 4: the distribution of pathological patterns of Diarrheagenic E. coli (DEC) in meat and meat products and the significant differences between them at the level of significance (P<0.05).
Discussion
The contamination with E. coli depends on the type of animal, breeding conditions, and slaughtering. Therefore, meat products consumed as human food need special attention and care as they play a major role in the transmission of many common diseases and food poisoning to humans (17). The high level of E. coli contamination in beef and buffalo meat is since the meat of these two cattle types is the main reservoirs for E. coli and is higher than the rest of the other cattle types because of their hooves and internal entrails. Meat may also be contaminated by the hands of the butchers, the walls, and floors of the slaughterhouses (18). The phenotypic characteristics of E. coli on a selective medium agree with the previous studies (10,19).
Ramires-Martinez and colleagues (13) indicate that when the primers of the uidA gene that encodes the enzyme (B-glucuronidase) common in all E. coli species in the PCR technique are used, a band with a molecular weight of 147 base pairs is given in all isolates and is positive for this gene.
The multiplexed polymerase chain reactions (mPCR) are performed to investigate the presence or absence of the virulence genes that encode the important virulence factors for the diagnosis of (DEC) by using specific primers to target each primer of a specific sequence of one of these genes and to ensure the subordination of these isolates in this study to these bacteria (DEC). The results of this study show that the primers differ in the number of amplification bands and their molecular weights according to the primer used. The difference between primers results is due to the presence or absence of complete sites for that initiator with similar sequences present in the genome of each isolate, and the absence of replication products for some isolates indicates the absence of binding sites for this primer in the genome of the bacterial isolate (12).
In other studies, the percentage of pathological types that cause diarrhea in Korea is 1.3% (20), and in Mexico is 1% (21), while the results of our study are in agreement with a positive sample 11.6% for the pathogenic E. coli types related to virulence genes and causing diarrhea in Dohuk governorate (22).
In this study, ETEC pathotype is the most common type that existed in approximately all positive samples that were examined, especially in imported chicken meat, pastirma, imported burger, minced meat, and beef. The results of the present study show lower percentages than those reported by Taha and Yassin (22). This does not agree with the study of Rugeles and coworkers (23) in which this pattern does not appear in the studied meat samples. Several studies, on the other hand, indicate that the ETEC pathotype is the most common type in fresh meat and meat products (24). Also, many studies indicate that the intestinal E. coli (ETEC) in ground meat and beef samples is the result of the contamination during the slaughtering by the fecal contamination of carcasses or the contamination in restaurants using a contaminated mincing machine or by the hands of workers. This indicates that meat, especially beef, and minced meat, is the main source of ETEC pathotype which is the main cause of traveler's diarrhea episodes (25).
This study shows a small percentage of diarrhea-causing type of DAEC, which is about 1.05% of the total isolates in the studied samples. The results of the study (18,19) reveal that a high contamination rate with DEC is associated with poor hygiene conditions during slaughtering, and poor meat storage in the shops, which may pose societal health risks to local people (26).
Conclusion
Cows and buffalos are considered the main reservoirs for E. coli more than the rest of the other cattle types. The meat produced from these animals needs more hygienic attention and care during slaughtering and treatment by workers to avoid any potential contamination. Also, the walls and floors of slaughterhouses must be carefully cleaned to maintain a healthy environment. All these factors play a major role in the transmission of many common diseases and cases of food poisoning. Because of the large number of pathotypes and virulence factors, culture or biochemical tests cannot distinguish between the pathological strains of these bacteria. Therefore, the multiplex Polymerase Chain Reaction (mPCR) technology is used to detect the presence or absence of several genes encoding major virulence factors for the diagnosis of DEC, particularly when dealing with large numbers of samples.
Conflict of interest
The authors declare no conflict of interest.
Acknowledgments
This study was conducted in the laboratories of the College of Education of pure science and College of Veterinary Medicine, University of Mosul, Iraq. Great thanks to the staff in these laboratories for providing the equipment, requirements, and facilities.