College of Veterinary Medicine / University of Mosul
  • Register
  • Login
  • العربیة

Iraqi Journal of Veterinary Sciences

Notice

As part of Open Journals’ initiatives, we create website for scholarly open access journals. If you are responsible for this journal and would like to know more about how to use the editorial system, please visit our website at https://ejournalplus.com or
send us an email to info@ejournalplus.com

We will contact you soon

  1. Home
  2. Volume 36, Issue 2
  3. Authors

Current Issue

By Issue

By Subject

Keyword Index

Author Index

Indexing Databases XML

About Journal

Aims and Scope

Editorial Board

Editorial Staff

Facts and Figures

Publication Ethics

Indexing and Abstracting

Related Links

FAQ

Peer Review Process

News

Genotyping of Salmonella enterica strains from animal and human origin using three molecular techniques

    Juan S. Cruz-Méndez Julián D. Ortiz-Muñoz Iang S. Rondon-Barragan

Iraqi Journal of Veterinary Sciences, 2022, Volume 36, Issue 2, Pages 531-538
10.33899/ijvs.2021.130764.1877

  • Show Article
  • Full Text
  • References
  • Download
  • Cite
  • Statistics
  • Share

Abstract

This study aims to characterize different Salmonella enterica subsp molecularly. enterica strains (n=49) were isolated from human gastrointestinal cases in the Tolima region and poultry from Santander and Tolima regions using PCR-RFLP, PCR-ribotyping, and PCR-SSCP. The band patterns obtained with each technique were analyzed by building dendrograms based on the Unweighted Pair Group Method with Arithmetic mean (UPGMA) method and using the Dice coefficient. On the other hand, the discriminatory power of each technique was assessed using Simpson's discriminatory index. The genetic profiles of the gnd gene obtained with AciI restriction enzyme and the PCR-SSCP carried out with groEL gene allowed the inter-and intraserovar differentiation. Finally, the PCR-ribotyping method exhibited the highest discriminatory power (0.8571). In conclusion, we show three PCR-based genotyping methods providing an alternative for identifying similarities and differences within Salmonella enterica strains from different geographic and biological regions.
Keywords:
    Salmonellosis Genetic profile Phylogeny Serotypes
Main Subjects:
  • Molecular Biology

Genotyping of Salmonella enterica strains from animal and human origin using three molecular techniques

 

Juan Sebastian Cruz-Méndez†, Julián David Ortiz-Muñoz †, Iang Schroniltgen Rondón-Barragán*

 

Poultry Research Group, Laboratory of Immunology and Molecular Biology, Department of Animal Health, Faculty of Veterinary Medicine and Zootechnics, University of Tolima, Ibagué, Colombia

 

†These authors contributed equally to this work.

 

isrondon@ut.edu.co

 

Abstract

 

This study aims to characterize different Salmonella enterica subsp molecularly. enterica strains (n=49) were isolated from human gastrointestinal cases in the Tolima region and poultry from Santander and Tolima regions using PCR-RFLP, PCR-ribotyping, and PCR-SSCP. The band patterns obtained with each technique were analyzed by building dendrograms based on the Unweighted Pair Group Method with Arithmetic mean (UPGMA) method and using the Dice coefficient. On the other hand, the discriminatory power of each technique was assessed using Simpson's discriminatory index. The genetic profiles of the gnd gene obtained with AciI restriction enzyme and the PCR-SSCP carried out with groEL gene allowed the inter-and intraserovar differentiation. Finally, the PCR-ribotyping method exhibited the highest discriminatory power (0.8571). In conclusion, we show three PCR-based genotyping methods providing an alternative for identifying similarities and differences within Salmonella enterica strains from different geographic and biological regions.

 

Keywords: Salmonellosis, Genetic profile, Phylogeny, Serotypes

 

Introduction

 

Salmonellosis is a zoonotic disease that affects different animal species such as cattle, sheep, poultry, and pigs, generating significant economic losses in the animal production industry (1). It is caused by different Salmonella serotypes, which are commonly isolated from food products of animal origin (1). More than 2600 Salmonella serotypes have been described, 1586 belonging to Salmonella enterica subsp. enterica, responsible for 99% of the salmonellosis cases in humans and warm-blooded animals (2,3). Annually, 93.8 million non-typhoidal salmonellosis cases and 150,000 deaths are reported worldwide. Likewise, 15.5 million typhoidal salmonellosis cases are reported annually, and 154000 of these cases are fatal (4). The White-Kauffmann-Le Minor scheme is a phenotyping method widely used for Salmonella serotyping (5), but it cannot distinguish the possible clonal origin of the isolates (6).

In contrast, PCR-based genotyping methods allows the discrimination of clonal origin, being a useful tool for epidemiological characterization of pathogens isolated from outbreaks at inter-and intraserovar level and determining the relationships within the isolates, all of these good generating reproducibility and discriminatory power (DP) values with a low requirement in time and specialized equipment (6,7). In Colombia, salmonellosis is under permanent surveillance through the programs of control and tracing of foodborne diseases, and despite there being information regarding circulating serotypes, little data regarding relationships of the distinct isolates are available (8). Therefore, this study aimed to molecularly characterize Salmonella enterica strains from different origins through three PCR-based genotyping techniques to establish the genetic differences among the isolates and infer the possible phylogenetic relationship of the strains.

 

Materials and methods

 

Bacterial strains

There are 50 Salmonella enterica strains, 49 belonging to 8 different serotypes and one reference Salmonella enterica subsp. enterica ser. Enteritidis (ATCC 13076®), used as amplification control, were evaluated. These strains were isolated in previous projects of our laboratory, of which ten correspond to isolates from human gastrointestinal cases in the Tolima region (9). Fifteen belong to poultry from the Santander region (10), and 24 are from the Tolima region (11). All strains have been previously characterized via the White-Kauffmann-Le Minor scheme and correspond to Salmonella enterica subsp. enterica serovar Enteritidis, Salmonella enterica subsp. enterica serovar Typhimurium, Salmonella enterica subsp. enterica serovar Braenderup, Salmonella enterica subsp. enterica serovar Newport, Salmonella enterica subsp. enterica serovar Grupensis, Salmonella enterica subsp. enterica serovar Uganda, Salmonella enterica subsp. enterica serovar Paratyphi B and Salmonella enterica subsp. enterica serovar Heidelberg.

 

Genomic DNA extraction

Genomic DNA was isolated from fresh bacterial colonies using Wizard Genomic DNA Purification Kit (Promega, USA), following the manufacturer's instructions. The isolated DNA was stored at -20°C until its use.

 

 

Molecular confirmation of Salmonella isolates

Molecular confirmation was carried out via PCR by amplifying a fragment of 284 bp of invA gene accession number: M90846.1, using specific primers (Table 1). Furthermore, S. Enteritidis (ATCC 13076®) was used as a positive control.

 

Table 1: Primers sequences were used for the three genotyping methods

 

Gene or target region

Primer

Sequence (5-3)

Amplicon length (bp)

Reference

fliC

F

CAAGTCATTAATACAAACAGCC

1,500

(12)

R

TTAACGCAGTAAAGAGAGGAC

gnd

F

CTGCGCCTGAATTAAGTTAGCTGG

1,266

(13)

R

GAAAGCCGTGGTTATACCGTCTCC

Ribosomal operon

F

GAGCAAACAGGATTAGATACCC

Variable

This study

R

TCGTGCAGGTCGGAACTTAC

groEL

F

CGCTCGTGTGAAAATGCTGC

1,598

This study

R

TACCACCCATACCACCCAT

invA

F

GTGAAATTATCGCCACGTTCGGGCAA

284

(14)

R

TCATCGCACCGTCAAAGGAACC

 

Genotyping

A total of 5 molecular markers were used: invA, fliC, gnd, groEL genes, and the 16S-23S rRNA Intergenic Spacer Region (ISR). In order to design specific primers and select the most suitable endonucleases, in silico analyses were performed using the GenBank database (Table 1). PCR experiments carried out for PCR-RFLP, PCR-ribotyping, and PCR-SSCP techniques were performed using 25 μl of total reaction volume, composed by 1 μl of template DNA, 5 μl of Flexi Buffer 5x colorless GoTaq® (Promega, USA), 1 μl of dNTPs (Invitrogen, USA), 5 μl of each primer (Table 1) at 10 pmol/mL (Macrogen, Korea), 1 μl of MgCl2 (25 mM) (Promega, USA), 0,125 μl of GoTaq Flexi DNA Polymerase (Promega, USA) and 14,875 μl of nuclease-free water. An initial denaturation at 95°C for 3 minutes, followed by 35 cycles comprising 30 seconds of denaturation at 95°C, 30 seconds of annealing step at 55°C for fliC, groEL, invA, and 16S-23S ISR rRNA genes and 60°C for gnd gene, an extension step at 72°C for 90 seconds for fliC and gnd genes, 120 seconds for groEL gene, 210 seconds for 16S-23S ISR rRNA and 30 seconds for invA gene, and a final extension at 72°C and 7 minutes were used. Electrophoresis was carried out in a vertical and continuous system in 10% non-denaturing polyacrylamide gels using 0,5X TBE as running buffer, the Mini PROTEAN Tetra Cell device (Bio-Rad, USA), and Diamond™ Nucleic Acid Dye (Promega, USA) as an intercalating agent. Conditions were 120V, 60 minutes for PCR-RFLP, and 70 minutes for PCR-ribotyping and PCR-SSCP.

 

PCR-RFLP

fliC and gnd genes were digested with HhaI and AciI, and the groEL gene was cleaved using HhaI and PstI. Restriction reactions followed the manufacturer’s instructions (NEB, USA).

 

PCR-ribotyping

16S-23S rRNA ISR was amplified for each strain. Then, double enzymatic digestion was carried out with HaeIII and SphI, following the manufacturer's instructions (NEB, USA).

 

PCR-SSCP

A 284 bp fragment of theinvA gene and the groEL-PstI restriction fragments were subjected to heat denaturation at 95°C for 15 minutes and then stored at -20°C until electrophoresis.

 

Sanger sequencing

The gnd gene of two S. Enteritidis isolates was sequenced by the Sanger method. The sequences were deposited in GenBank with accession numbers MZ028205 and MZ028206. Bioinformatic analyses were performed with Geneious Prime Software version 2021.1.

 

Fingerprinting

The genetic profiles generated by each technique were analyzed with BioNumerics software version 8.0 (Applied Maths NV, Belgium), calculating the genetic distances with Dice coefficient (15). In addition, to generate dendrograms, the UPGMA method was used. Furthermore, combined analysis using the genetic profiles obtained with the three techniques were also performed. Finally, the DP of each technique was measured through Simpson's discriminatory index (16).

 

Results

 

PCR amplification of molecular markers

PCR amplified all molecular markers from all Salmonella enterica isolates (n=49).

 

PCR-RFLP

The RFLP analysis of the fliC gene restricted with HhaI showed three commons and five specific patterns (SP) (Table 2). fliC cleaved with AciI endonuclease exhibited five common and 3 SP (Table 2). The DP of fliC patterns generated with HhaI and AciI was 0.6471 and 0.6718, respectively. Furthermore, gnd digested with HhaI showed four standard and 2 SP (Table 2), while the restriction of this gene with AciI enzyme generated four standard (RP-C1 to RP-C4) and 5 SP (RP-U1 to RP-U5) (Figure 1). For gnd-HhaI, the calculated DP was 0.6088 and 0.6726 for gnd-AciI. Finally, the groEL gene cleaved with PstI generated one profile for all strains and a DP of 0 (Table 2). On the other hand, groEL restriction with HaeIII produced four common and 1 SP, with a DP of 0.6446 (Table 2).

 

 

 

Figure 1: Dendrogram from restriction patterns of gnd gene cleaved with AciI endonuclease. The tree was generated through UPGMA and Dice coefficient.

 

PCR-ribotyping

Twelve genetic profiles were obtained, with seven common (RT-C1 to RT-C7) and five specific ribotypes (RT-U1 to RT-U5) (Figure 2.); the DP was 0.8571, yielding the highest value out of the three methods.

 

 

 

Figure 2: Dendrogram from restriction patterns of 16S-23S rRNA ISR cleaved with HaeIII and SphI endonucleases. The tree was generated through UPGMA and Dice coefficient.

 

PCR-SSCP

The invA PCR-SSCP fingerprints showed five common (SS-C1 to SS-C5) and one specific profile (SS-U1) (Figure 3), yielding a DP of 0.6675. Furthermore, groEL-PstI SSCP fingerprints generated four common and 5 SP, describing a DP of 0.6726 (Table 2).

 

 

Figure 3: Dendrogram from denatured fragments of invA gene. The tree was generated through UPGMA and Dice coefficient.

 

 

Sanger sequencing

Obtained sequences were different in 62 nucleotides, which represents an identity of 89.99%. Furthermore, for AciI, 5 and 13 restriction sites were found in S. Enteritidis isolates 43 and 46, respectively. For HhaI, 7 and 12 restriction sites were found for isolates 43 and 46, respectively. On the other hand, 2 AciI and 7 HhaI restriction sites are conserved in both strains (Figure 4).

 

 

 

Figure 4: Pairwise alignment and restriction map of the gnd gene from 2 S. Enteritidis strains

 

Combined analysis

fliC-HhaI+fliC-AciI; fliC-HhaI+gnd-HhaI; fliC-HhaI+groEL-HhaI and fliC-AciI+groEL-HhaI combined analyses yielded a value of 0.6726 and generated dendrograms with 9 clusters and one branch for each serotype, excluding S. Enteritidis, which were grouped in 2 branches. SSCP invA+fliC-HhaI yielded a 0.6726 DP value and a dendrogram with 9 clusters; finally, by combining the three techniques as follows, fliC-HhaI+fliC-AciI+gnd-HhaI+gnd-AciI+groEL-HhaI+SSCP invA+SSCP groEL-PstI+ribotyping, 12 genetic profiles were generated, and a DP of 0.8571 was described (Table 2).

 

Table 2: The discriminatory power of individual and combined genotyping methods

 

Genotyping method

Molecular marker

Restriction

enzyme

Common profiles

Specific profiles

Number of

strains per profile

DP

 

fliC

HhaI

3

5

17,1,3,1,1,1,1,24

0.6471

 

AciI

5

3

3,1,1,2,1,24,2,15

0.6718

 

gnd

HhaI

4

2

15,27,1,2,1,3

0.6088

RFLP

AciI

4

5

15,2,1,24,

0.6726

 

1,1,1,3,1

 

groEL

HhaI

4

1

3,25,5,1,15

0.6446

 

PstI

1

0

49

0

PCR-ribotyping

16S-23S rRNA

HaeIII-SphI

 

 

2,1,3,3,8,13,

 

ISR

7

5

1,1,1,1,5,10

0.8571

 

 

 

 

 

SSCP

groEL

PstI

4

5

24,1,2,1,1,3,1,1,15

0.6726

invA

-

5

1

4,3,2,1,24,15

0.6675

RFLP+RFLP

fliC-HhaI+fliC-AciI

4

5

15,2,1,1,1,1,3,1,24

0.6726

RFLP+RFLP

fliC-HhaI+gnd-HhaI

4

5

15,2,1,1,1,1,24,3,1

0.6726

RFLP+RFLP

fliC-HhaI+groEL-HhaI

4

5

3,1,24,1,1,1,1,2,15

0.6726

RFLP+RFLP

fliC-AciI+groEL-HhaI

4

5

24,1,3,1,1,1,1,2,15

0.6726

SSCP+RFLP

SSCP invA+fliC-HhaI

4

5

15,2,1,3,1,1,1,1,24

0.6726

All genotyping methods combined

7

5

3,1,1,1,1,3,8,

0.8571

13,1,2,5,10

 

Discussion

 

PCR-RFLP

 

fliC gene encodes for phase 1 flagellin, and it has been previously reported as present throughout the whole Salmonella genus (12). Furthermore, this gene has a hypervariable central region flanked by two conserved regions at 5 and 3 ends, representing suitable regions for primers annealing (7). In addition, the PCR-RFLP technique using this gene and HhaI enzyme allowed the differentiation of 6 out of 8 serotypes due to its lack of discrimination between S. Heidelberg and S. Typhimurium. Nonetheless, S. Braenderup and S. Newport isolates were differentiated as opposed to the reported by (7).

On the other hand, the gnd gene encodes the 6-phosphogluconate dehydrogenase enzyme, which belongs to the pentose phosphate pathway (7). RFLP fingerprints generated with gnd gene and HhaI were capable of distinguishing between S. Heidelberg, S. Typhimurium, S. Grupensis, and S. Enteritidis, which agrees with the in silico analyses, while S. Paratyphi B, S. Newport, S. Braenderup, and S. Uganda were not experimentally discriminated, which is opposite to bioinformatic analyses. This methodology yielded a DP of 0.6088. Moreover, the cleavage of the gnd gene with the AciI enzyme yielded a DP of 0.6726, representing a low value as stated by (16). However, it was the only RFLP methodology to assign one specific pattern to each serotype, the highest type ability of all RFLP methods.

Additionally, S. Grupensis, S. Typhimurium, and S. Heidelberg's distinctive genetic profiles obtained through groEL-HhaI and the intraserovar differentiation within S. enteritidis strains could be explained variable regions distributed intermittently between the conserved zones in the groEL gene (17). The patterns generated by cleaving the groEL gene with HhaI described a DP of 0.6446. Finally, all of the PCR-RFLP methods were able to describe an intraserovar differentiation within S. Enteritidis isolates, and their DP was less than 0.9 (16), represents low values, cannot be described as suitable genotyping methods.

 

PCR-ribotyping

Interserovar differences for the eight serotypes analyzed and intraserovar differentiation observed only with this method for S. Heidelberg and S. Paratyphi B could be due to point mutations and insertion/deletions (indels) of more significant segments (18) in the multiple copies of ISR. In the same way, previous studies have reported that ISR is polymorphic among some Salmonella enterica serotypes (19). Under our conditions, a DP of 0.8571 for PCR-ribotyping was calculated. It can be considered close to optimal for genotyping techniques (16), and it is higher than the described by (19), who reported a DP of 0.167. It is essential to highlight that (19) only amplified 16S-23S ISR and did not perform a restriction digest step. Additionally, we obtained intraserovar differentiation for the 4 S. Enteritidis strains, which differs from the reported by (18), who described a shared pattern for 41 S. Enteritidis strains. However, the methodology used by these authors does not include an enzymatic digestion step, suggesting that enzymatic restriction with two enzymes can increase the DP of this method.

 

PCR-SSCP

Salmonella enterica invA gene encodes for the invasion protein A, which has a vital role in the bacterial binding to the intestinal epithelium during infection. Therefore, this gene is highly conserved, is also described as specific for the Salmonella genus, and is used to identify several serotypes (14). In this study, a 284 bp fragment of the invA gene was amplified in all strains before denaturation. Using this method, we identified a DP of 0.6675, which differs from the DP of 0.799 reported by (19). Furthermore, our DP results could be considered lower than the fair values for genotyping methods (16). Additionally, (14) described a correlation between the different PCR-SSCP profiles and the variations found by sequencing the invA gene from several Salmonella isolates. However, the PCR-SSCP patterns obtained with this gene could not identify a specific profile for each serotype, although the strains were grouped according to the isolation source (Figure 3).

On the other hand, being the PCR-SSCP sensitivity of up to 89% in amplicons shorter than 450 bp (20), the groEL gene PCR products were subjected to enzymatic restriction with PstI endonuclease in order to obtain suitable length fragments before the denaturation step. The denatured fragments from S. Typhimurium isolates showed the same pattern, while two band patterns were generated for the 4 S. Enteritidis isolates, describing intraserovar differentiation for this serotype. This finding is similar to the reported by (21), who performed enzymatic digestion of a 1.6 kb fragment of groEL gene with HaeIII endonuclease, describing three profiles among 11 S. Enteritidis strains one shared profile for 5 S. Typhimurium isolates. The DP value of our methodology was 0.6726, with nine patterns for the eight serotypes.

On the other hand, the PCR-RFLP results indicated no different PstI restriction sites on the groEl gene of the studied strains. In contrast, PCR-SSCP showed that the nucleotide composition of this gene is heterogeneous within the strains, which generated different single-stranded patterns and inter-and intraserovar differentiation. Moreover, this method generated nine profiles for the eight serotypes and inter-and intraserovar differentiation, equal to the PCR-RFLP results from the gnd gene cleaved with AciI (Table 2), both methods yielding the same typeability percentage and DP. Finally, the PCR-SSCP of the invA gene required less time to be carried out than the other techniques.

 

Combined analysis of genotyping methods and Salmonella enterica strains relationships

In general, combined analysis with PCR-RFLP increased the DP compared to the individual methods, which agrees with (22), who suggested that more than two genes and restriction enzymes could increase the heterogeneity of genetic profiles, thereby improving the DP. In the same way, the combination of several genotyping methods may increase the discrimination of Salmonella enterica serotypes (23), which agrees with our results of SSCP invA+fliC-HhaI, but it is opposite to the composite analysis with the three methods. Additionally, none of the combinations yielded a DP or genetic profile number higher than PCR-ribotyping, PCR-RFLP of gnd gene with AciI enzyme, or groEL-PstI PCR-SSCP as individual methods. Salmonella Enteritidis differentiation with all methods. The Salmonella Typhimurium homogeneity found in this study contrasts with the serotypes data in Colombia since S. Enteritidis has been reported as a clonal group, while S. Typhimurium is a highly genetically diverse serotype (24). Noteworthily, the profiles assigned by the three genotyping methods and their combinations were able to describe a specific fingerprint for each serotype, agreeing with the previous serotyping of the isolates, and allowed us to describe intraserovar differentiations that are not perceivable with serotyping. Similarly, PCR-based genotyping methods have been previously used to differentiate Salmonella enterica strains at and below serotype level (7, 25). However, our purpose is not to replace but to complement the traditional typing methods for Salmonella enterica to provide valuable data regarding the relationships within isolates, information that can be used in epidemiological surveillance.

 

Conclusion

 

Our study showed three PCR-based genotyping methods as tools for Salmonella enterica inter-and intraserovar discrimination, generating clusters according to the different geographical origins and isolation sources.

 

Acknowledgments

 

We thank the Laboratory of Immunology and Molecular Biology in Ibagué, Colombia, for supporting this project.

 

Conflict of interest

 

The authors declare that there are no conflicts of interest regarding the publication of this manuscript.

  • PDF (1467 K)
  • XML
(2022). Genotyping of Salmonella enterica strains from animal and human origin using three molecular techniques. Iraqi Journal of Veterinary Sciences, 36(2), 531-538. doi: 10.33899/ijvs.2021.130764.1877
Juan S. Cruz-Méndez; Julián D. Ortiz-Muñoz; Iang S. Rondon-Barragan. "Genotyping of Salmonella enterica strains from animal and human origin using three molecular techniques". Iraqi Journal of Veterinary Sciences, 36, 2, 2022, 531-538. doi: 10.33899/ijvs.2021.130764.1877
(2022). 'Genotyping of Salmonella enterica strains from animal and human origin using three molecular techniques', Iraqi Journal of Veterinary Sciences, 36(2), pp. 531-538. doi: 10.33899/ijvs.2021.130764.1877
Genotyping of Salmonella enterica strains from animal and human origin using three molecular techniques. Iraqi Journal of Veterinary Sciences, 2022; 36(2): 531-538. doi: 10.33899/ijvs.2021.130764.1877
  • RIS
  • EndNote
  • BibTeX
  • APA
  • MLA
  • Harvard
  • Vancouver

  1. Demirbilek SK. Salmonellosis in Animals. USA: InTech Open; 2018. 19-32. DOI: 10.5772/intechopen.72192
  2. Nwabor OF, Dickson ID, Ajibo QC. Epidemiology of Salmonella and Salmonellosis. Int Lett Nat Sci. 2015;47:54-73.
  3. Ryan MP, O’Dwyer J, Adley CC. Evaluation of the complex nomenclature of the clinically and veterinary significant pathogen Salmonella. Biomed Res Int. 2017;2017. DOI: 10.1155/2017/3782182
  4. Global Health Data Exchange. Global Burden of Disease Results Tool. [available at]
  5. Grimont PA, Weill FX. Antigenic formulae of the Salmonella serovars. WHO collaborating center for reference and research on Salmonella. Paris: Pasteur Institute; 9:1-166. [available at]
  6. Riley LW. Laboratory methods in molecular epidemiology: Bacterial infections. Microbiol Spectr. 2018;6. DOI: 10.1128/microbiolspec.AME-0004-2018
  7. Hong Y, Liu T Hofacre C, Maier M, White DG, Ayers S, Wang L, Maurer JJ. A restriction fragment length polymorphism-based polymerase chain reaction as an alternative to serotyping for identifying Salmonella serotypes. Avian Dis. 2003;47:387-395. DOI: 10.1637/0005-2086(2003)047[0387:ARFLPP]2.0.CO;2
  8. Rubiano C, Torres M. Reportes de brotes y aislamientos de Salmonella spp. en Colombia. Cult. Científica, pp. 74-83, 2014. [available at]
  9. Fandiño LC, Verján-García NA common Salmonella Enteritidis sequence type from poultry and human gastroenteritis in Ibagué, Colombia. Biomedica. 2019;39. DOI: 10.7705/biomedica.v39i1.4155

10. Castro-Vargas R, Fandiño de Rubio L, Vega A, Rondón-Barragán I. Phenotypic and genotypic resistance of Salmonella Heidelberg isolated from one of the largest poultry production regions from Colombia. Int J of Poult Sci. 2019;18:610-617. DOI: 10.3923/ijps.2019.610.617

11. Rodríguez-Hernández R, Bernal JF, Cifuentes JF, Fandiño LC, Herrera-Sánchez MP, Rondón-Barragán I, Verjan-García N. Prevalence and molecular characterization of Salmonella isolated from broiler farms at the Tolima region-Colombia. Animals. 2021;11:970. DOI: 10.3390/ani11040970

12. Dauga C, Zabrovskaia A, Grimont PA. Restriction fragment length polymorphism analysis of some flagellin genes of Salmonella enterica. J Clin Microbiol. 1998;36(10):2835-2843. DOI: 10.1128/JCM.36.10.2835-2843.1998

13. Soler-García ÁA, De Jesús AJ, Taylor K, Brown EW. Differentiation of Salmonella strains from the SARA, SARB, and SARC reference collections by using three genes PCR-RFLP and the 2100 Agilent Bioanalyzer. Front Microbiol. 2014;5. DOI: 10.3389/fmicb.2014.00417

14. Rahn K, De Grandis SA, Clarke RC, McEwen SA, Galán JE, Ginocchio C, Curtiss R, Gyles, CL. Amplification of an invA gene sequence of Salmonella Typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol Cell Probes. 1992;6:271-279. DOI: 10.1016/0890-8508(92)90002-F

15. Dice LR. Measures of the amount of ecologic association between species. Ecology. 45;26:297-302. DOI: 10.2307/1932409

16. Hunter PR, Gaston MA. Numerical index of the discriminatory ability of typing systems:An application of Simpson's index of diversity. J Clin Microbiol. 1988;26:2465-2466. DOI: 10.1128/jcm.26.11.2465-2466.1988

17. Hu YS, Liu JH, Pang XL, Chen SY, Chen XG. Phylogenetic analysis and PCR-restriction fragment length polymorphism identification of Salmonella based on groEL gene sequence. Journal of Southern Medical University. 2009;29:2037-2043. Chinese. [available at]

18. Kashyap SK, Maherchandani S, Kumar N. Ribotyping: A tool for molecular taxonomy. USA: Elsevier Inc; 2014. 327-344. DOI: 10.1016/B978-0-12-416002-6.00018-3

19. Lagatolla C, Dolzani L, Tonin E, Lavenia A, Di Michele M, Tommasini T, Monti-Bragadin, C. PCR ribotyping for characterizing Salmonella isolates of different serotypes. J Clin Microbiol. 1996;34:2440-2443. DOI: 10.1128/jcm.34.10.2440-2443.1996

20. Al-Adhami BH, Huby-Chilton F, Blais BW, Martinez-Perez A, Chilton NB, Gajadhar AA. Rapid discrimination of Salmonella isolates by single-strand conformation polymorphism analysis. J Food Protect. 2008;71(10):1960-1966. DOI: 10.4315/0362-028x-71.10.1960

21. Nair S, Lin TK, Pang T, Altwegg M. Characterization of Salmonella Serovars by PCR-Single-Strand Conformation Polymorphism Analysis. J Clin Microbiol. 2002;40:2346-2351. DOI: 10.1128/JCM.40.7.2346-2351.2002

22. Moradi Bidhendi S, Alaei F, Khaki P, Ghaderi R. . Identification of avian Salmonella isolates by PCR-RFLP analysis of a fliC gene fragment. Arch. Razi Inst.. 2015;70(1), 1-6.

23. Hyeon JY, Chon JW, Park JH, Kim MS, Oh YH, Choi IS, Seo KH. Comparison of subtyping methods for differentiating Salmonella enterica serovar enteritidis isolates obtained from food and human sources. Osong Public Health Res Perspect. 2013;4:27-33. DOI: 10.1016/j.phrp.2012.12.005

24. Rodríguez EC, Díaz-Guevara P, Moreno J, Bautista A, Montaño L, Realpe ME, della Gaspera, A, Wiesner M. Laboratory surveillance of Salmonella enterica from human clinical cases in Colombia 2005-2011. Enferm Infecc Microbiol Clin. 2017;35:417-425. DOI: 10.1016/j.eimce.2017.06.006

25. Lozano-Villegas K, Rodríguez-Hernández R, Rondón-Barragán I. Effectiveness of six molecular typing methods as epidemiological tools for the study of Salmonella isolates in two Colombian regions. Vet World. 2019;12:1998-2006. DOI: 10.14202/vetworld.2019.1998-2006

  • Article View: 187
  • PDF Download: 79
  • LinkedIn
  • Twitter
  • Facebook
  • Google
  • Telegram
  • Home
  • Glossary
  • News
  • Aims and Scope
  • Privacy Policy
  • Sitemap

 

© 2022, College of Veterinary Medicine, University of Mosul

 
This journal is licensed under a Creative Commons Attribution 4.0 International (CC-BY 4.0)

Powered by eJournalPlus