College of Veterinary Medicine / University of Mosul
  • Register
  • Login
  • العربیة

Iraqi Journal of Veterinary Sciences

Notice

As part of Open Journals’ initiatives, we create website for scholarly open access journals. If you are responsible for this journal and would like to know more about how to use the editorial system, please visit our website at https://ejournalplus.com or
send us an email to info@ejournalplus.com

We will contact you soon

  1. Home
  2. Volume 36, Issue 2
  3. Authors

Current Issue

By Issue

By Subject

Keyword Index

Author Index

Indexing Databases XML

About Journal

Aims and Scope

Editorial Board

Editorial Staff

Facts and Figures

Publication Ethics

Indexing and Abstracting

Related Links

FAQ

Peer Review Process

News

Some immunological responses in rats injected with prepared bacterin toxoid of local methicillin resistant Staphylococcus aureus

    Abdullah A. Abdulazeez Sheehan Mohammed H. Khudor Fanar A. Isihak

Iraqi Journal of Veterinary Sciences, 2022, Volume 36, Issue 2, Pages 401-406
10.33899/ijvs.2021.130401.1815

  • Show Article
  • Highlights
  • Full Text
  • References
  • Download
  • Cite
  • Statistics
  • Share

Abstract

This study was aimed to prepare bacterin toxoid from local isolate of methicillin resistant Staphylococcus aureus (MRSA) isolated from bovine mastitis in Basrah province. Isolated MRSA was detected and confirmed using polymerase chain reaction. Then inactivated bacterin toxoid was prepared. A total of 45 male albino rats were used in 3 mainly groups to assess the bacterin toxoid. For immunological response, the concentrations of IL-4, CD4+, and CD8+ T-cells were estimated using enzyme linked immunosorbent assay. The results showed increase in the concentrations of IL-4, CD4+ and CD8+ T-cells in vaccinated group comparing with non-vaccinated control group. Increasing concentrations of IL-4 enhance humoral immune response by stimulation of Th2 that effect directly on B-cells differentiating them to plasma cells responsible for production of specific antibodies against MRSA. Increased CD4+T-cells also enhance humoral immune response as a result of interaction between them and antigen-presenting cells which presented major histocompatibility complex (MHC) type II on their surface, while increased CD8+T-cells enhance cellular immune response as a result of interaction between them and somatic effected cells presented MHC type I on their surface leading to differentiation them to Cytotoxic T lymphocytes (CTLs) responsible for the killing of effected cells. It was concluded that locally prepared bacterin toxoid proved their efficacy to stimulate both humoral and cell mediated immunity in rats as an experimental animal model.
Keywords:
    Vaccine Staphylococcus aureus bactrin toxoid MRSA
Main Subjects:
  • Veterinary Microbiology

Some immunological responses in rats injected with prepared bacterin toxoid of local methicillin resistant Staphylococcus aureus

 

Abdullah Abdulazeez Sheehan1, Mohammed H. Khudor2 and Fanar A. Isihak1

 

1Department of Microbiology, College of Veterinary Medicine, University of Mosul, 2Department of Microbiology, College of Veterinary Medicine, University of Basrah

 

abdshaeehan@uomosul.edu.iq, 0000-0002-8851-8992

mohamed.khudor@uobasrah.edu.iq, 0000-0002-5699-5241

fanar1976@uomosul.edu.iq, 0000-0002-6409-3969

 

Abstract

 

This study was aimed to prepare bacterin toxoid from local isolate of methicillin resistant Staphylococcus aureus (MRSA) isolated from bovine mastitis in Basrah province. Isolated MRSA was detected and confirmed using polymerase chain reaction. Then inactivated bacterin toxoid was prepared. A total of 45 male albino rats were used in 3 mainly groups to assess the bacterin toxoid. For immunological response, the concentrations of IL-4, CD4+, and CD8+ T-cells were estimated using enzyme linked immunosorbent assay. The results showed increase in the concentrations of IL-4, CD4+ and CD8+ T-cells in vaccinated group comparing with non-vaccinated control group. Increasing concentrations of IL-4 enhance humoral immune response by stimulation of Th2 that effect directly on B-cells differentiating them to plasma cells responsible for production of specific antibodies against MRSA. Increased CD4+T-cells also enhance humoral immune response as a result of interaction between them and antigen-presenting cells which presented major histocompatibility complex (MHC) type II on their surface, while increased CD8+T-cells enhance cellular immune response as a result of interaction between them and somatic effected cells presented MHC type I on their surface leading to differentiation them to Cytotoxic T lymphocytes (CTLs) responsible for the killing of effected cells. It was concluded that locally prepared bacterin toxoid proved their efficacy to stimulate both humoral and cell mediated immunity in rats as an experimental animal model.

 

Keywords: Vaccine, Staphylococcus aureus, bactrin toxoid, MRSA

 

بعض الاستجابات المناعیة فی الفئران المحقونة بالذوفان الجرثومی المحضر من المکورات العنقودیة الذهبیة المقاومة للمیثیسیلین

 

عبدالله عبدالعزیز شیحان1، محمد حسن خضر2 و فنار ابلحد اسحق1

 

1فرع الاحیاء المجهریة، کلیة الطب البیطری، جامعة الموصل، الموصل، ٢فرع الأحیاء المجهریة، کلیة الطب البیطری، جامعة البصرة، البصرة، العراق

 

الخلاصة

 

استهدفت هذه الدراسة إمکانیة تحضیر الذوفان الجرثومی المعطل من العزلة المحلیة لبکتیریا المکورات العنقودیة الذهبیة المقاومة للمیثیسیلین والمعزولة من حالة التهاب الضرع البقری فی محافظة البصرة. تم الکشف عن بکتیریا المکورات العنقودیة الذهبیة المقاومة للمیثیسیلین وتأکیدها باستخدام تفاعل البلمرة المتسلسل وبعد ذلک تم تحضیر الذوفان الجرثومی منها. تم استخدام مجموع خمس وأربعون جرذا من ذکور الجرذان البیضاء مقسمة فی ثلاثة مجامیع رئیسیة لتقییم الذوفان الجرثومی. للاستجابة المناعیة، تم تقدیر تراکیز الانترلوکین الرابع والخلایا التائیة بنوعیها CD4+ و CD8 + باستخدام الالیزا. أظهرت النتائج زیادة فی تراکیز الانترلوکین الرابع والخلایا التائیة بنوعیه CD4+ وCD8+ فی المجموعة الملقحة مقارنة مع مجموعة السیطرة غیر الملقحة. أن زیادة تراکیز الانترلوکین أدى إلى تحفیز الخلایا التائیة المساعدة من النوع الثانی والتی أثرت بشکل مباشر على الخلایا البائیة مؤدیة تمایزها إلى خلایا البلازما المسؤولة عن إنتاج الأجسام المضادة المتخصصة ضد العزلة من بکتیریا المکورات العنقودیة الذهبیة المقاومة للمیثیسیلین. الزیادة فی تراکیز الخلایا التائیة نوعCD4+ قد عززت الاستجابة المناعیة الخلطیة أیضا نتیجة للتفاعل بینها وبین الخلایا المناعیة المقدمة للمستضدات والتی تحمل على سطحها معقد التوافق النسیجی الکبیر من النوع الثانی بینما الزیادة فی تراکیز الخلایا التائیة نوع CD8+عززت الاستجابة المناعیة الخلویة نتیجة للتفاعل بینها وبین الخلایا الجسمیة المتأثرة والمقدمة للمستضدات والتی تحمل على سطحها معقد التوافق النسیجی الکبیر من النوع الأول مؤدیة فی النهایة تمایزها إلى الخلایا التائیة السامة والمسؤولة عن قتل الخلایا المصابة.

 

Introduction

 

Bovine mastitis one of the serious diseases that considered a challenge to the economy of dairy animals and milk production, among the important causative agent of this disease Staphylococcus aureus is one of the more problematic pathogens that affect dairy farms and causes both acute and chronic mastitis (1). Many virulent factors exhibited by Staph. aureus such as excreting a wide range of enterotoxins and exotoxins to it is living environment in addition to specific mechanism attributed by it such as biofilm formation, antibiotic resistance, help it to colonization and develop to skin and mammary gland infection of cow causing mastitis (2). In addition to ability of MRSA to transmission between animals and man (3). Many strategies were used for controlling mastitis such as improved nutrition, environmental sanitation, use of teat sealants (4), cleaning of teats with antiseptic before and after each milking, contentious cleaning of milking machines, culling of chronically diseased animals (5). Treatment of mastitis by antibiotics may be of value in some cases, but the presence of MRSA, as pathogenic organism, is a major problem. Because it is resistance against wide range of antibiotics that used in the field (6). Using of antibiotics by hazard may lead to transmission antibiotic resistance factors between microorganisms (7). For these reasons vaccination still the better method for the control bovine mastitis caused by MRSA (1). There are many types of vaccines have been used to prevent much more serious diseases both in man and animals around the world, these vaccines included, killed or inactivated vaccines, live attenuated vaccines, sub unite vaccines, nucleic acid-based vaccines which included DNA and RNA vaccines (8), finally toxoid or bacterin toxoid which means inactivation of toxins produced by bacteria that cause damage of the tissue and produce disease in the host, these pathogenic toxins can be inactivated or detoxified by heating or adding chemical substances such as formaldehyde or using both (8). Therefore, the aims of this study were to prepare inactivated bacterin toxoid from a local isolate of methicillin-resistant Staphylococcus aureus and evaluate the immunological response in rats as an experimental animal model.

 

Materials and methods

 

Bacterial strain

Strong biofilm producing MRSA strain, isolated from bovine mastitis, was obtained from central research laboratory, College of Veterinary Medicine, University of Basrah. All the requirements for conducting the search were done in College of Veterinary Medicine, University of Mosul.

 

Molecularly detection of the local MRSA strain

The MRSA strain was detected by PCR for each of the following genes: nuc gene: a universal gene for Staph. aureus, mec A gene: antibiotic resistance gene to methicillin (9), ica A and ica D genes: biofilm producing genes (10).

 

Bacterin toxoid preparation

The bacterin toxoid has been prepared according to Giraudo et al. (11) with modification as: the strong biofilm-producing MRSA strain was firstly activated on nutrient agar. A single colony from growing MRSA in mannitol salt agar was elected for the production of the vaccine which was cultured on ten plates of blood agar at 37ºC for 48 hours, the growing bacterial cultures were harvested then to 50 ml of modified nutrient broth which was composed of 90% nutrient broth with 10% of Iraqi buffalo whey, the benefit of whey in this modified medium was to stimulate MRSA and facilitate of pseudocapsule formation. Then, it was incubated at 37ºC for 48 hours to allow for maximum encapsulation of the bacteria. After that 50 ml of 0.8% formalin was added (V/V) and incubated at 37ºC for 24 hours to kill the bacterial growth mass. Sixty-five milliliters of it have been centrifuged at cold centrifuge 4ºC for 60 minutes at 4100 xg, the supernatant has been discarded while the pellet was re-suspended in PBS and has been washed three times. Finally, the pellet was suspended in PBS and adjusted by spectrophotometer at OD 600 to become 1.2 x 1010 CFU/ml. On other hand, remained 35 ml has been entered into the autoclave for 20 min at 121ºC and 15 bar then it has been centrifuged at 4100 xg for 60 minutes. The supernatant has been kept at - 80ºC as crude toxoid for further use later while the pellet has been discarded. The prepared bacterin toxoid has been filled and sealed in 5 ml capacity test tubes after adding each of the following: 3.5 ml of pellet suspension with 1.5 ml of crude toxoid with preservatives that have been added before sealing it which were included each of the following: 0.0005 gm of sodium azide with 0.0005 gm of thiomersal with 20 microliters of 0.4% formalin. After that each tube has been sealed and kept under deep freeze - 80ºC to be used later in the vaccination of the experimental animals.

 

Sterility, safety and purity tests

The prepared bacterin toxoid was examined for each sterility test, by culturing of the prepared vaccine on every of nutrient agar, blood agar, mannitol salt agar, brain heart infusion agar and also of nutrient broth, brain heart infusion broth which were kept under 37ºC for 48 hours to detect any intact bacterial growth. The safety test was done by injecting ten of male albino rats with 0.3 ml of prepared bacterin toxoid subcutaneously and they were followed up for one week to detect any possible undesirable side effect (post vaccinal reactions). Finally, purity test was carried out bypreparing the smears from bacterin toxoid and stained using Gram’s stain to detect the presence of any intact bacteria.

 

Study design       

A total of 45 male Wistar albino rats at 8 weeks’ age and 200-220 grams’ body weight/animal, were used in 3 mainly groups and each main group was divided into three sub-groups which they were used as follow: the first group was composed of 15 animals divided into three sub-groupsby 5 animals for each sub-group used to show the effect of locally prepared bacterin toxoid. All animals in three sub-groups were vaccinated S/C with prime vaccination dose at 0 day with 0.3 ml of a mixture of prepared bacterin toxoid with Complete Freund Adjuvant (CFA). After 5 days first sub-group animals were killed according to animal ethics committees after blood was collected from them and serum was separated to detect each of IL-4, CD4+ T-cells and CD8+ T-cells concentrations by ELISA. At 14 days, remained two sub-groups of animals were vaccinated S/C with first booster dose 0.25 ml of a mixture of prepared bacterin toxoid with IncompleteFreund Adjuvant (IFA). At 19 days the second subgroup animals were killed after blood were collected from them and serum separated to follow up of IL-4, CD4+ T-cells and CD8+ T-cells concentrations. At 28 days, the final remained sub-group were vaccinated S/C with a second booster dose with 0.2 ml of a mixture of prepared bacterin toxoid with IFA and at 33 days they were killed after blood was collected from them and serum separated to follow up of IL-4, CD4+ T-cells and CD8+ T-cells concentrations. The same program was used for each of the second control positive group which were treated with an inactivated commercial vaccine MASTIVAC® from OVEJERO company/Spain inactivated polyvalent vaccine and the third control negative group which was treated with PBS only.

 

DNA extraction

The MRSA DNA was extracted using DNA extraction kit (Prestoᵀᵐ Mini g DNA Bacterial kit under Lot No. FF14110-G, Geneaid company) (12).

 

Primers and PCR program

Four sets of primers were used and provided by Alpha DNA company, Montreal (Table 1).

 

Table 1: Sets and size of primers of Staph. aureus genes

 

Primer

Sequence of the primers (5’ to 3’)

Product size /bp

Reference

nuc gene

F

GCGATTGATGGTGATACGGTT

279 bp

(13)

R

AGCCAAGCCTTGACGAACTAAAGC

ica A gene

F

GAGGTAAAGCCAACGCACTC

151 bp

(14)

R

CCTGTAACCGCACCAAGTTT

ica D gene

F

ACCCAACGCTAAAATCATCG

211 bp

(14)

R

GCGAAAATGCCCATAGTTTC

mec A gene

F

AAAATCGATGGTAAAGGTTGGC

533 bp

(15)

R

AGTTCTGCAGTACCGGATTTGC

 

Polymerase chain reaction (PCR)

It has been done as follow: 4 µl of the extracted DNA of MRSA bacteria has been used as DNA template in a mini-Eppendorf tube 200 µl capacity. 1 µl of each forward and reverse primers of the target gene has been added to the tube. 12.5 µl of master mix (Green mix) PROMEGA/USA, has been added to the tube. 6.5 µl of nuclease-free water PROMEGA / USA, has been added to the tube. All the components of the tube have been mixed well by a mini centrifuge. Finally, the tube has been entered into the PCR thermocycler type (Biometra, Germany) machine according to the specific program for every gene (Table 2).

 

Table 2: PCR program for each primer

 

 Program

ºC/minutes - Cycle

Reference

Primary denaturation

Denaturation

Annealing

Extension

Final extension

nuc

94/5-1

94/1-34

55/1-34

72/1-34

72/10-1

(13)

ica A + D

95/5-1

95/0.3-40

60/0.3-40

72/0.3-40

72/3-1

(14)

mec A

95/5-1

94/0.5-40

55/0.5-40

72/1-40

72/5-1

(15)

 

Gel electrophoresis

PCR product was electrophoresed in 2% of agarose gel that stained with ethidium bromide and DNA ladder with 11 fragments 100-1000 bp plus a band at 1500 bp in size (PROMEGA/USA) was used. The electrophoresis apparatus was optimized at 50V for 75 min. After that DNA bands have been read by transilluminator (Biometra/Germany).

 

ELISA assay

ELISA assay has been used to determine the concentrations of IL-4, CD4+ and CD8+ T-cells (Elabscience®/USA).

 

Statistical analysis

SPSS version 23 was used and one-way analysis of variance ANOVA with LSD and Duncan test were used for analyzing of data. Significant difference between groups were estimated at P≤0.05.

 

Results

 

Molecular detection of MRSA local isolate

Specific primers with 279 bp, 533 bp, 151 bp and 211 bp sizes which were used for amplification of nuc gene,mec A geneica A and ica D genes respectively (specific genes for MRSA). These genes were successfully amplified by PCR from the extracted DNA of MRSA which mean the local isolate was positive for each of nuc gene, mec A gene, ica A and ica D genes indicating that the local isolate was biofilm producing methicillin resistant Staph aureus strain (Figure 1).

 

 

 

Figure 1: Amplification of: A- nuc gene with 279 bp in size B- mec A gene with 533 bp in size, C- ica A gene with 151 bp in size, D- ica D gene with 211 bp in size electrophoresed in 2% of agarose gel stained with ethidium bromide and using DNA ladder of 1500 bp in size.

 

Sterility safety, and purity tests

The result of sterility test was negative indicating no growing bacteria in cultured media with prepared bacterin toxoid. All of the injected animals were followed up for one week indicating the safety of vaccine, there was no shown any undesirable side effect due to post vaccination reaction or effects. Finally, the purity test was also negative for intact bacteria in Gramʼs stained smears.

 

IL-4 concentration

The results showed significance increase in the IL-4 concentrations in vaccinated group with prepared bacterin toxoid in compare with non-vaccinated control group at each of 5, 19, 33 days, whereas in comparing of control to vaccinated group with an inactivated commercial vaccine there was significant increases only in first 5 days with no any other increase in 19 and 33 days. Also, in comparison between each of vaccinated group with prepared bacterin toxoid and group vaccinated with an inactivated commercial vaccine the results showed no any significance between them at 5 days but there was a significant decrease in IL-4 concentration in the at 19 and 33 days (Table 3).

 

Table 3: The IL-4 concentration (pg/ml) at 5, 19 and 33 days in vaccinated and control groups

 

Groups

mean ± standard deviation

5 days

19 days

33days

Control

392.92 ± 61.22

370.78 ± 18.30

383.26 ± 23.80

Bacterin toxoid

837.75 ± 125.05*

765.25 ± 115.87*

879.43 ± 118.10*

Inactivated commercial vaccine

736.64 ± 190.79*

543.93 ± 250.06**

511.54 ± 178.48**

*mean presence significance between vaccinated and non-vaccinated control groups at the same column. **mean presence significance between vaccinated groups with prepared and inactivated commercial vaccine each to other at the same column. Significance value under P≤0.05

 

CD4+ T-cells concentration

The results showed a significant increase in the concentration of CD4+ T-cells in both vaccinated groups with each of prepared bacterin toxoid and inactivated commercial vaccine in compare with non-vaccinated control group at 5, 19 and 33 days respectively. Also, the results showed significant increase in CD4+ T-cells concentration in group vaccinated with an inactivated commercial vaccine comparing with group vaccinated with prepared bacterin toxoid at 5 days only with no any significance between them in in 19 and 33 days respectively (Table 4).

 

Table 4: The CD4+ T-cells concentration (pg/ml) at 5, 19 and 33 days in vaccinated and control groups

 

Groups

mean ± standard deviation

5 days

19 days

33days

Control

742.89 ± 86.83

815.31 ± 112.35

767.84 ± 63.25

Bacterin toxoid

1387.64 ± 463.12*

1665.44 ± 373.66*

1691.84 ± 196.14*

Inactivated commercial vaccine

1941.43 ± 130.28* **

1540.39 ± 374.72*

1825.09 ± 390.27*

*mean presence significance between vaccinated and non-vaccinated control groups at the same column. **mean presence significance between vaccinated groups with prepared and inactivated commercial vaccine each to other at the same column. Significance value under P≤0.05.

 

CD8+ T-cell concentrations

The results in table 5 explain a significant increase in the concentration of CD8+ T-cells between vaccinated groups with each of prepared bacterin toxoid and inactivated commercial vaccine respectively in compare with non-vaccinated control group at 5 day only, while at 19 day the results showed a significant increase in concentration of CD8+ T-cells only in vaccinated group with prepared bacterin toxoid in compare with non-vaccinated control group and no change in the concentration of CD8+T-cells in vaccinated group with an inactivated commercial vaccine . Also, the results clarified change in time progression within the vaccinated group with prepared bacterin toxoid by significant decrease in concentration of CD8+ T-cells at 33 days in comparing with 5 and 19 days (Table 5).

 

Table 5: The CD8+ T-cells concentration (pg/ml) at 5, 19 and 33 days in vaccinated and control groups

 

Groups

mean ± standard deviation

5 days

19 days

33days

Control

44.17 ± 11.33

43.23 ± 9.29

42.12 ± 9.24

Bacterin toxoid

79.88 ± 0.06*

66.93 ± 9.93*

58.42 ± 18.82a

Inactivated commercial vaccine

66.44 ± 14.33*

53.42 ± 20.99

59.85 ± 23.26

*mean presence significance between vaccinated and non-vaccinated control groups at the same column. Small litters mean presence significance inside the same group with time progression at the same row. Significance value under P≤0.05.

 

Discussion

 

Vaccination against MRSA considered the best suitable method for controlling of mastitis in dairy cows due to possession of MRSA many of virulent factors such as antibiotic resistant, excretion of enteric and exotoxins in addition to it is ability to formation of biofilm that complex the problem of infection by changing the infection by it to chronic form (2). So, vaccination considered easy and suitable method for controlling of bovine mastitis caused by MRSA. Our results showed significant increase in IL-4 concentrations in vaccinated animals with prepared bacterin toxoid and this may indicate for humoral immune response enhancement. Our result agree with Misra et al. (16) who demonstrated elevation in IL-4 level as a result of vaccination.IL-4 level elevation in vaccination process may due to several reasons, T-helper cells can differentiate mainly in to Th1 and Th2 cells, at first time IL-4 effect on naïve CD4+ T-cells or TH0 (naïve T-helper) leading to differentiation them into Th2 cells but not Th1 cells, Th2 cells lead to enhancement and produce additional amount of IL-4 by feedback loop mechanism and this process was called position feedback loop (17). Also, IL-4 effect directly on a subset of T-cells which was called T-helper CD4+T-cells producing IL-4 that finally enhances IL-4 itself production later (18). Naïve CD4+ was able to the production of IL-4 at the prime, later this produced IL-4 lead to activation and differentiation of these cells in to effector T-cells responsible for further IL-4 production (19). One of the important function of IL-4, the ability to promote further production of IL-4 from Th2 cells that effect directly on B-cells leading to differentiation of these cells to plasma cells which were responsible for the specific antibody production against target antigen so it was called sometimes B-cell growth factor (20), another function of IL-4, it plays an important role in the expression of MHC II molecules that enhance the humoral immune response by acting it directly on CD4+T-cells (21), so IL-4 play an important role in humoral immunity but not cell-mediated immunity. Our results showed presence significant increase in the concentrations of CD4+T-cells in vaccinated group with prepared bacterin toxoid in comparison with non-vaccinated control group at each of 5, 19 and 33 days respectively and this indicate that the locally prepared vaccine succeeded in the stimulation of potent humoral immune response against prepared vaccine which was used in the study. Our result agreed with Misra et al. (16) that indicated presence significant increase in CD4+ levels due to vaccination against MRSA, also agreed with Zuo et al. (22) that vaccination with chimeric bivalent vaccine caused strong T-cell response to vaccine. Also, our result showed a significant increase in CD8+ T-cells that agreed with at each of 5 and 19 days then it decreased significantly at 33 days in a vaccinated group with locally prepared bacterin toxoid also there was a significant increase in CD8+ T-cells at 5 days only in the vaccinated group with an inactivated commercial vaccine, these results may agree with Misra et al. (16), Zuo et al. (22) which they revealed increase T-cell response to vaccination. In addition, it may have indicated that MRSA may act as intracellular pathogen sometimes and this may lead to increase concentrations of CD8+T-cells that were activated throughout vaccination and differentiated to cytotoxic T-lymphocytes CTLs which they were responsible for cell-mediated immunity by killing these cells and elimination of the intracellular pathogen. Rollin et al. (23) referred that MRSA bacteria can be lived inside endothelial cells which were responsible for relapsed infection after full treatment with antibiotics. Staph. aureus bacteria may be considered now a day non-classical facultative intracellular bacterium giving them the chance to behave as intracellular and extracellular pathogen in the host at the same time (24). One of an important factor that helps Staph. aureus bacteria to live as an intracellular pathogen is sigma factor B which was important operon allows Staph aureus to cause silent chronic infection later (25). So, the ability of Staph aureus to live intracellular pathogen gives the chance for CD8+ T-cells to differentiate to cytotoxic T-lymphocyte that kill these cells and eliminate these intracellular pathogens.

 

Conclusion

 

It was concluded that locally prepared bacterin toxoid proved their efficacy to stimulate both humoral and cell mediated immunity in rats as an experimental animal model.

 

Acknowledgment

 

The researchers extend their thanks and gratitudeto University of Mosul and Basrah University to support this study.

 

Conflict of Interest

 

The authors declare that there is no conflict of interest.

Article highlights

 

1-       The inactivated bacterin toxoid stimulate both humoral and cellular immunity

2-       The inactivated bacterin toxoid lead to elevation of IL-4, CD4+ and CD8+ T-cells

3-       Conventional PCR and ELISA were used to estimate parameters throughout of the study

  • PDF (656 K)
  • XML
(2022). Some immunological responses in rats injected with prepared bacterin toxoid of local methicillin resistant Staphylococcus aureus. Iraqi Journal of Veterinary Sciences, 36(2), 401-406. doi: 10.33899/ijvs.2021.130401.1815
Abdullah A. Abdulazeez Sheehan; Mohammed H. Khudor; Fanar A. Isihak. "Some immunological responses in rats injected with prepared bacterin toxoid of local methicillin resistant Staphylococcus aureus". Iraqi Journal of Veterinary Sciences, 36, 2, 2022, 401-406. doi: 10.33899/ijvs.2021.130401.1815
(2022). 'Some immunological responses in rats injected with prepared bacterin toxoid of local methicillin resistant Staphylococcus aureus', Iraqi Journal of Veterinary Sciences, 36(2), pp. 401-406. doi: 10.33899/ijvs.2021.130401.1815
Some immunological responses in rats injected with prepared bacterin toxoid of local methicillin resistant Staphylococcus aureus. Iraqi Journal of Veterinary Sciences, 2022; 36(2): 401-406. doi: 10.33899/ijvs.2021.130401.1815
  • RIS
  • EndNote
  • BibTeX
  • APA
  • MLA
  • Harvard
  • Vancouver

  1. Côté-Grave J, and Malouin F. Symposium review: Features of Staphylococcus aureus mastitis pathogenesis that guide vaccine development strategies. J Dairy Sci. 2019;102:1-14. DOI: 10.3168/jds.2018-15272
  2. Abril AG, Villa TG, Barros-Velázquez J, Cañas B, Sánchez-Pérez A, Calo-Mata P, Carrera M. Review: Staphylococcus aureus exotoxins and their detection in the dairy industry and mastitis. Toxins. 2020;12:537. DOI: 10.3390/toxins12090537
  3. Hado HA, Assafi MS. Molecular fingerprinting of methicillin resistant Staphylococcus aureus strains isolated from human and poultry in Duhok, Iraq. Iraqi J Vet Sci. 2021;35(1):99-103. DOI: 10.33899/ijvs.2020.126375.1310
  4. Dego OK. Control and Prevention of Mastitis: Part Two. Anim Reprod Vet Med. 2020;1-11. DOI: 10.5772/intechopen.93484
  5. Vliegher SD, Ohnstad I, Piepers P. Management and prevention of mastitis: A multifactorial approach with a focus on milking, bedding and data-management. J Integrate Agri. 2018;17(6):1214-1233. DOI: 10.1016/S2095-3119(17)61893-8
  6. Assafi MS, Hado HA, Abdulrahman IS. Detection of methicillin resistant Staphylococcus aureus in broiler and broilers farm workers in Duhok, Iraq by using conventional and PCR techniques. Iraqi J Vet Sci. 2020;34(1):15-22. DOI: 10.33899/ijvs.2019.125757.1145
  7. Hamad MA, Hussein SA, Mahmmoud EN, AL-Aalim AM. The inhibitory role of effective microorganisms on the growth of pathogenic bacteria. Iraqi J Vet Sci. 2020;34(1):153-158. DOI: 10.33899/ijvs.2019.125653.1123
  8. D’Amico C, Fontana F, Cheng R, Santos HA. Development of vaccine formulations: Past, present, and future. Drug Delivery Translat Res. 2021;11:353-372. DOI:  10.1007/s13346-021-00924-7
  9. Wielders CLC, Fluit AC, Brisse S, Verhoef J, Schmitz FJ. mecA gene is widely disseminated in Staphylococcus aureus Population. J Clin Microbiol. 2002;40(11):3970-3975. DOI: 10.1128/JCM.40.11.3970-3975.2002
  10. Otto M. Staphylococcal biofilms. Bacterial Biofilms. 2008;207-228. DOI: 10.1007/978-3-540-75418-3_10
  11. Giraudo JA, Calzolari A, Rampone H, Rampone A, Giraudo AT, Bogni C, Larriesrtra A, Nagel R. Field trials of a vaccine against bovine mastitis. J Dairy Sci. 1997;80(5):845-853. DOI: 10.3168/jds.s0022-0302(97)76006-5  
  12. Hussein SA. Study of Staphylococcus aureus isolated from the mouth of canary. Iraqi J Vet Sci.2020;34(2):301-304 DOI: 10.33899/ijvs.2019.125937.1192
  13. Fasihi Y, Kiaei S, Kalantar-Neyestanaki D. Characterization of SCC mec and spa types of methicillin-resistant Staphylococcus aureus isolates from health-care and community-acquired infections in Kerman, Iran. J Epidemiol Global Hlth. 2017;7(4):263-267. DOI: 10.1016/j.jegh.2017.08.004  
  14. Atshan SS, Shamsudin MN, Karunanidhi A, Van Belkum A, Lung LTT, Sekawi Z, Nathan JJ, Ling KH, Seng JSC, Ali AM, Abduljaleel SA, Hamat RA. Quantitative PCR analysis of genes expressed during biofilm development of methicillin resistant S. aureus (MRSA). Infect Genet Evolut. 2013;18(8):106-112. DOI: 10.1016/j.meegid.2013.05.002
  15. Murakami K, Minamide W, Wada K, Nakamura E, Reraoka H, Watanabe S. Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction. J Clin Microbiol. 1991;29(10);2240-2244. DOI: 10.1128/JCM.29.10.2240-2244.1991
  16. Misra N, Wines TF, Knopp CL, Hermann R, Bond L, Mitchell B, Tinker JK. Immunogenicity of a Staphylococcus aureus -cholera toxin A2/B vaccine for bovine mastitis. Vaccine. 2018;36(24), 3513-3521. DOI: 10.1016/j.vaccine.2018.04.067
  17. Gadani SP, Cronk JC, Norris GT, Kipnis J. IL-4 in the Brain: A Cytokine To Remember. J Immunol. 2012;189(9):4213-4219. DOI: 10.4049/jimmunol.1202246 
  18. Seder RA. The presence of interleukin 4 during in vitro priming determines the lymphokine-producing potential of CD4+ T cells from T cell receptor transgenic mice. J Experiment Med.1992;176(4):1091-1098. DOI: 10.1084/jem.176.4.1091
  19. Silva-Filho JL, Caruso-Neves C, Pinheiro AS. IL-4: An important cytokine in determining the fate of T cells. Biophysical Rev. 2014;6(1):111-118. DOI: 10.1007/s12551-013-0133-z  
  20. Howard M, Farrar J, Hilfiker M, Johnson B, Takatsu K, Paul WE. Identification of a T cell-derived b cell growth factor distinct from interleukin 2. J Experiment Med. 1982;155(3):914-923. DOI: 10.1084/jem.155.3.914  
  21. Roehm NW, Liebson HJ, Zlotnick A, Kappler J, Marrack P, Cambier JC. Interleukin-induced increase in Ia expression by normal mouse B cells. J Experiment Med. 1984;160(3):679-694. DOI: 10.1084/jem.160.3.679  
  22. Zuo QF, Yang LY, Feng Q, Lu DS, Dong YD, Cai CZ, Zou QM. Evaluation of the protective immunity of a novel subunit fusion vaccine in a murine model of systemic MRSA infection. PLoS ONE. 2013;8(12):81212. DOI: 10.1371/journal.pone.0081212
  23. Rollin G, Tan X, Tros F, Dupuis M, Nassif X, Charbit A, Coureuil M. Intracellular survival of Staphylococcus aureus in endothelial cells: A matter of growth or persistence. Frontiers Microbiol. 2017:8. DOI: 10.3389/fmicb.2017.01354  
  24. Sendi P, Proctor RA. Staphylococcus aureus as an intracellular pathogen: The role of small colony variants. Trends Microbiol. 2009;17(2):54-58. DOI: 10.1016/j.tim.2008.11.004
  25. Tuchscherr L, Bischoff M, Lattar SM, Noto Llana M, Pförtner H, Niemann S, Geraci j, Van de Vyver H, Fraunholz MJ, Cheung AL, Herrmann M, Völker U, Sordelli DO, Peters J, Löffler B. Sigma factor SigB is crucial to mediate Staphylococcus aureus adaptation during chronic infections. PLOS Pathogens. 2015;11(4):1-26. DOI: 10.1371/journal.ppat.1004870    

  • Article View: 162
  • PDF Download: 102
  • LinkedIn
  • Twitter
  • Facebook
  • Google
  • Telegram
  • Home
  • Glossary
  • News
  • Aims and Scope
  • Privacy Policy
  • Sitemap

 

© 2022, College of Veterinary Medicine, University of Mosul

 
This journal is licensed under a Creative Commons Attribution 4.0 International (CC-BY 4.0)

Powered by eJournalPlus